CDC42BPA

Ensembl ID:
ENSDARG00000058760
Description:
CDC42 binding protein kinase alpha (DMPK-like) [Source:HGNC Symbol;Acc:1737]
Human Orthologue:
CDC42BPA
Human Description:
CDC42 binding protein kinase alpha (DMPK-like) [Source:HGNC Symbol;Acc:1737]
Mouse Orthologue:
Cdc42bpa
Mouse Description:
CDC42 binding protein kinase alpha Gene [Source:MGI Symbol;Acc:MGI:2441841]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18095 Nonsense Available for shipment Available now
sa36323 Nonsense Mutation detected in F1 DNA During 2016
sa14618 Essential Splice Site Available for shipment Available now
sa2899 Essential Splice Site Available for shipment Available now
sa18292 Essential Splice Site Available for shipment Available now
sa39147 Nonsense Mutation detected in F1 DNA During 2016
sa36324 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18095
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081651 Nonsense 335 1757 8 38
Genomic Location (Zv9):
Chromosome 17 (position 8259357)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8262029
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YCCGCAGACTCATCTGCTGCAGAGAGCACAGGCTRGGGCAGAACGGCATY[G/T]AGGACTTCAAACAACACCCCTTCTTCTCTGGCATTGACTGGCAGAACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36323
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081651 Nonsense 688 1757 15 38
Genomic Location (Zv9):
Chromosome 17 (position 8270542)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8273214
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTCCAAGCACGGGGTCGTCTGAGCAGAACCAAGAGCTTAGTAAACTA[C/T]GAGCAGACCTGGAAAAGAAGACGGTGCACTTCAAAGAAGAGCTTTCCCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14618
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081651 Essential Splice Site 895 1757 19 38
Genomic Location (Zv9):
Chromosome 17 (position 8284645)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8286238
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGGATGAGCTCAACAAAGTCAAGGCATCCCATATGGCTACTGAGTGG[T/G]AAAACACACAGCTCTTCTTTAAAGTACAAGAGKKGGTAGATCTGAAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2899
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081651 Essential Splice Site 1066 1757 25 38
Genomic Location (Zv9):
Chromosome 17 (position 8292652)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8294258
KASP Assay ID:
554-2596.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTACGTCTCTGATGGTGGGGATCATCCGTCAGGGCTGCACGTGTGAAGG[T/C]GAGACAGGTCATTTACGCTGAAACTGATGGCGTTGTAAAAATGGTAACTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa18292
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081651 Essential Splice Site 1111 1757 26 38
Genomic Location (Zv9):
Chromosome 17 (position 8292878)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8294484
KASP Assay ID:
2261-0651.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCGACCCTCARAAGGGCATCGGCACAGCATATGAGGGCCACGTAAAG[G/T]TTAGACAYTTCAGTTWAAATTACCATSAACAATTTGTGATCAAAATRAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39147
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081651 Nonsense 1202 1757 29 38
Genomic Location (Zv9):
Chromosome 17 (position 8300822)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8301410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGACAGCATCACAGCTCTGCGCCTCCAGCAATAAAAAATGCTCCATTT[T/A]GATCCTGGCCGACAGCGATCAGGAAAGAACAAAGTGGGTCGGCCTTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36324
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081651 Essential Splice Site 1512 1757 32 38
Genomic Location (Zv9):
Chromosome 17 (position 8309793)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8310371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTGATGTCAACACTATGGAGTGGATTCAAACAATTCCTTTGAAAAAG[G/A]TACATTTTTATTTTTCCTTATGAGCAAAGAAAAAAACACACAAATGCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link