LOC100329262

Ensembl ID:
ENSDARG00000058753

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24070 Nonsense Available for shipment Available now
sa687 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24070
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105866 Nonsense 157 343 2 3
Genomic Location:
Chromosome 22 (position 6903471)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTGAGGGAGATTCAGTCACTCTACACACCGGTGTTAAAACAGACCAA[C/T]AGGACAGAATTGTGTGGTTTAATGAAGGCAGTCGTGTCGCTGTAATCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa687
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105866 Nonsense 162 343 2 3
Genomic Location:
Chromosome 22 (position 6903454)
KASP Assay ID:
554-0595.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCACTCTACACACYGGTGTTAAAACAGACCAACARGACAGAATTGTGTG[G/A]TTTAATGAAGGCAGTCGTGTCRCTGTAATCAGYGGAGATCTCARTGTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ua3bsjqn