LOC100329262

Ensembl ID:
ENSDARG00000058753

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29711 Nonsense Mutation detected in F1 DNA During 2015
sa24070 Nonsense Available for shipment Available now
sa687 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29711
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105866 Nonsense 108 343 1 3
Genomic Location:
Chromosome 22 (position 6906195)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGATCTCTGACCGTCATGAACACCAGACTCAGAGATGCTGGAGAATA[T/A]CAGCTACTGATCAGCAGCAGCAAAAGCATCAATGAAATGATCTTCAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24070
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105866 Nonsense 157 343 2 3
Genomic Location:
Chromosome 22 (position 6903471)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTGAGGGAGATTCAGTCACTCTACACACCGGTGTTAAAACAGACCAA[C/T]AGGACAGAATTGTGTGGTTTAATGAAGGCAGTCGTGTCGCTGTAATCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa687
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105866 Nonsense 162 343 2 3
Genomic Location:
Chromosome 22 (position 6903454)
KASP Assay ID:
554-0595.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCACTCTACACACYGGTGTTAAAACAGACCAACARGACAGAATTGTGTG[G/A]TTTAATGAAGGCAGTCGTGTCRCTGTAATCAGYGGAGATCTCARTGTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ua3bsjqn