LOC557779

Ensembl ID:
ENSDARG00000058738
Human Orthologue:
SLC26A6
Human Description:
solute carrier family 26, member 6 [Source:HGNC Symbol;Acc:14472]
Mouse Orthologue:
Slc26a6
Mouse Description:
solute carrier family 26, member 6 Gene [Source:MGI Symbol;Acc:MGI:2159728]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24254 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24254
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081654 Nonsense 732 786 20 22
Genomic Location:
Chromosome 23 (position 6994788)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGTCGAGATTATGCCAAGGTAGATGTCACTGTTTACATTTCTGGATGT[C/T]AAGGTGGGTAAAACTGAGATAAACCCCTAAATAAAGCATAAACATCTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cm4nrzo8