ihha

Ensembl ID:
ENSDARG00000058733
ZFIN ID:
ZDB-GENE-051010-1
Description:
Indian hedgehog homolog a [Source:RefSeq peptide;Acc:NP_001030165]
Human Orthologue:
IHH
Human Description:
Indian hedgehog [Source:HGNC Symbol;Acc:5956]
Mouse Orthologue:
Ihh
Mouse Description:
Indian hedgehog Gene [Source:MGI Symbol;Acc:MGI:96533]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
hu2131 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu2131
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081660 Nonsense 44 413 1 3
Genomic Location:
Chromosome 9 (position 7400713)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGGACATGGGAAAAGGCGGCCTCCGAAGAAACTGACACCCCTTAATTA[C/A]AAGCAGTTTAGTCCAAATGTAGCCGAGAAGACACTGGGAGCCAGCGGGAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
  • Height: Genome-wide association analysis identifies 20 loci that influence adult height. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qqwvx7zh