rdh10a

Ensembl ID:
ENSDARG00000058730
ZFIN ID:
ZDB-GENE-070112-2242
Description:
Retinol dehydrogenase 10-A [Source:UniProtKB/Swiss-Prot;Acc:A1L1W4]
Human Orthologue:
RDH10
Human Description:
retinol dehydrogenase 10 (all-trans) [Source:HGNC Symbol;Acc:19975]
Mouse Orthologue:
Rdh10
Mouse Description:
retinol dehydrogenase 10 (all-trans) Gene [Source:MGI Symbol;Acc:MGI:1924238]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8453 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8453
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066703 Nonsense 82 339 1 6
ENSDART00000146790   None 155 None 4

The following transcripts of ENSDARG00000058730 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 13176679)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 13128127
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGGACATCAACAGCCACAGCAATGAGGAGACTGCGGAGATGGTGCGA[C/T]AGATCTACAGAGAGCAGGACAACCCGATGTCAAAAGAGGGTACATTTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link