akirin2

Ensembl ID:
ENSDARG00000058729
ZFIN ID:
ZDB-GENE-040426-2944
Description:
akirin-2 isoform 2 [Source:RefSeq peptide;Acc:NP_998459]
Human Orthologue:
AKIRIN2
Human Description:
akirin 2 [Source:HGNC Symbol;Acc:21407]
Mouse Orthologue:
Akirin2
Mouse Description:
akirin 2 Gene [Source:MGI Symbol;Acc:MGI:1889364]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7923 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7923
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081643 Nonsense 155 180 4 5

The following transcripts of ENSDARG00000058729 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 2747812)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGAGGCTCTTTAATATTTATCTACAATGTTTGCTCTTGTGTCTCCAGAA[C/T]AGTACGATGCGTTTGTGAAGTTCACCCATGACCAGCTGATGAGGCGGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3ocdd706