rfesd

Ensembl ID:
ENSDARG00000058725
ZFIN ID:
ZDB-GENE-050417-254
Description:
Rieske (Fe-S) domain containing [Source:RefSeq peptide;Acc:NP_001017740]
Human Orthologue:
RFESD
Human Description:
Rieske (Fe-S) domain containing [Source:HGNC Symbol;Acc:29587]
Mouse Orthologue:
Rfesd
Mouse Description:
Rieske (Fe-S) domain containing Gene [Source:MGI Symbol;Acc:MGI:2145198]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12771 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12771
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081652 Nonsense 59 165 3 4
Genomic Location:
Chromosome 21 (position 10254638)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACTGTGTCTTTTCCCCTTTTACAGATGCTGGMAGCACATTAGAAACT[G/T]GAGATATTGAGGTAAAGCCATTCTTCTCAAGCCACTGMCTCACTYAATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j8urpl1d