si:dkey-119f1.1

Ensembl ID:
ENSDARG00000058719
ZFIN ID:
ZDB-GENE-070705-287
Description:
structural maintenance of chromosomes protein 6 [Source:RefSeq peptide;Acc:NP_001121806]
Human Orthologue:
SMC6
Human Description:
structural maintenance of chromosomes 6 [Source:HGNC Symbol;Acc:20466]
Mouse Orthologue:
Smc6
Mouse Description:
structural maintenance of chromosomes 6 Gene [Source:MGI Symbol;Acc:MGI:1914491]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6006 Nonsense Mutation detected in F1 DNA During 2017
sa19667 Essential Splice Site Available for shipment Available now
sa38310 Nonsense Mutation detected in F1 DNA During 2017
sa39764 Nonsense Mutation detected in F1 DNA During 2017
sa39763 Nonsense Mutation detected in F1 DNA During 2017
sa14490 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6006
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081633 Nonsense 65 1090 2 26
Genomic Location (Zv9):
Chromosome 2 (position 6015211)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 6460939
KASP Assay ID:
554-3916.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGGGCATTATCGAGAGCATCTCTCTGAGAAACTTCATGTGCCATTCGT[T/A]GCTCGGGCCCTTTGCGTTTGGTCCAAACGTCAACTTTGTCGTAGGAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19667
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081633 Essential Splice Site 165 1090 4 26
Genomic Location (Zv9):
Chromosome 2 (position 6010893)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 6456621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAATTTCCAGTGAGGGAATCCGAACGTACAAACTTAAAAGCCACACCGG[T/C]ATGCCTACAATTACACTAACGGTTTATTTTTGGGTAGCTTTAAGGGATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38310
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081633 Nonsense 480 1090 13 26
Genomic Location (Zv9):
Chromosome 2 (position 5988672)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 6434400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGACTCTAAACAGCGTGACCTGGCCGCCATGGAAAGTAGTCGAAATAAC[C/T]AGCTTCGTCGTTTTGGCGAGCACATACCAGCACTGATGGAGGCTATAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39764
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081633 Nonsense 681 1090 17 26
Genomic Location (Zv9):
Chromosome 2 (position 5981769)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 6427497
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTAAACTAATGTGTGTCTTCTTTTTTCCAGACATTTGCAGTCTGCTCTA[C/T]AGACCCAGAGAGCACAGTTGGATCGCTTTCAGCAGGACATGCAGCAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39763
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081633 Nonsense 823 1090 20 26
Genomic Location (Zv9):
Chromosome 2 (position 5976934)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 6422662
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAACAGTGATCAGGAGGTGGAGAGGAGTAAACACCACAGAAAACACTA[T/A]GAGGAAAAACGAAAAACCCACTTGCAAATGATCGAGACACTAAAGACGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14490
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081633 Nonsense 1019 1090 24 26
Genomic Location (Zv9):
Chromosome 2 (position 5968554)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 6414282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCTTCGTCCTGTCACTGTGGGAAATTGCTGAAGTTCCTTTCCGTGCCT[T/A]GGATGAGTTTGAKGTCTATATGGTACAAAAAAACAAAAATAACCTGGTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link