si:dkey-208b23.1

Ensembl ID:
ENSDARG00000058716
ZFIN ID:
ZDB-GENE-081105-47
Description:
hypothetical protein LOC560225 [Source:RefSeq peptide;Acc:NP_001138264]
Human Orthologue:
CEPT1
Human Description:
choline/ethanolamine phosphotransferase 1 [Source:HGNC Symbol;Acc:24289]
Mouse Orthologue:
Cept1
Mouse Description:
choline/ethanolaminephosphotransferase 1 Gene [Source:MGI Symbol;Acc:MGI:2139793]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2461 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa2461
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081601 Essential Splice Site 118 426 2 8
Genomic Location (Zv9):
Chromosome 8 (position 13476073)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12921417
KASP Assay ID:
554-3375.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTACAAAGTTACATTTAGGCCTGCTTTATTACAGTTTCACCTCTTTTGC[A/T]GGCACCAACGTGGGCATATTTGGCATGTGCTTTGGGTTTGTTCATCTACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link