terf1

Ensembl ID:
ENSDARG00000058710
ZFIN ID:
ZDB-GENE-090612-2
Description:
LOC566954 protein [Source:UniProtKB/TrEMBL;Acc:A7MD83]
Human Orthologues:
TERF1, TERF1P2
Human Descriptions:
telomeric repeat binding factor (NIMA-interacting) 1 pseudogene 2 [Source:HGNC Symbol;Acc:38110]
telomeric repeat binding factor (NIMA-interacting) 1 [Source:HGNC Symbol;Acc:11728]
Mouse Orthologue:
Terf1
Mouse Description:
telomeric repeat binding factor 1 Gene [Source:MGI Symbol;Acc:MGI:109634]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24459 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24459
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106008 Nonsense 335 386 10 10
ENSDART00000134482 Nonsense 314 365 10 10
ENSDART00000139212 None None 303 None 9

The following transcripts of ENSDARG00000058710 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 13241948)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGAGAATCAATGTGTTGTTGTTTTTTGTTTGTTTGTTTTTTCAGAAAT[G/A]GACTGATGTAGAAGACAAGAAGCTGAAAGCAGGTGTGAAGAAACATGGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5gy3c3f8