terf1

Ensembl ID:
ENSDARG00000058710
ZFIN ID:
ZDB-GENE-090612-2
Description:
LOC566954 protein [Source:UniProtKB/TrEMBL;Acc:A7MD83]
Human Orthologues:
TERF1, TERF1P2
Human Descriptions:
telomeric repeat binding factor (NIMA-interacting) 1 pseudogene 2 [Source:HGNC Symbol;Acc:38110]
telomeric repeat binding factor (NIMA-interacting) 1 [Source:HGNC Symbol;Acc:11728]
Mouse Orthologue:
Terf1
Mouse Description:
telomeric repeat binding factor 1 Gene [Source:MGI Symbol;Acc:MGI:109634]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24459 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa24459
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106008 Nonsense 335 386 10 10
ENSDART00000134482 Nonsense 314 365 10 10
ENSDART00000139212   None 303 None 9

The following transcripts of ENSDARG00000058710 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 13241948)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGAGAATCAATGTGTTGTTGTTTTTTGTTTGTTTGTTTTTTCAGAAAT[G/A]GACTGATGTAGAAGACAAGAAGCTGAAAGCAGGTGTGAAGAAACATGGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5gy3c3f8