ddr2b

Ensembl ID:
ENSDARG00000058695
ZFIN ID:
ZDB-GENE-060503-361
Description:
Novel protein similar to vertebrate discoidin domain receptor family, member 2 (DDR2) [Source:UniPro
Human Orthologue:
DDR2
Human Description:
discoidin domain receptor tyrosine kinase 2 [Source:HGNC Symbol;Acc:2731]
Mouse Orthologue:
Ddr2
Mouse Description:
discoidin domain receptor family, member 2 Gene [Source:MGI Symbol;Acc:MGI:1345277]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19669 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19669
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081613 Nonsense 457 838 10 16
ENSDART00000147146 Nonsense 441 822 9 15
Genomic Location (Zv9):
Chromosome 2 (position 6690054)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7113624
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGAGAGAGGCGTTTGTCCACCGCAGCTCCTCTCTGTCCAGCGACGTC[G/T]AATCCACTTCCACATACGAGCGCATTTTCCCATTGGGATCTGACTATCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link