cast

Ensembl ID:
ENSDARG00000058693
ZFIN ID:
ZDB-GENE-050810-2
Description:
calpastatin [Source:RefSeq peptide;Acc:NP_001124063]
Human Orthologue:
CAST
Human Description:
calpastatin [Source:HGNC Symbol;Acc:1515]
Mouse Orthologue:
Cast
Mouse Description:
calpastatin Gene [Source:MGI Symbol;Acc:MGI:1098236]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8530 Nonsense Mutation detected in F1 DNA During 2014
sa23868 Nonsense Mutation detected in F1 DNA During 2014
sa15221 Essential Splice Site Available for shipment Available now
sa14469 Nonsense Available for shipment Available now
sa11266 Nonsense Available for shipment Available now
sa3122 Nonsense F2 line generated During 2014
sa14830 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8530
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081614 Nonsense 48 819 3 30
ENSDART00000131448 Nonsense 44 220 2 8
ENSDART00000132699 Nonsense 48 828 3 30
ENSDART00000133171 None None 190 None 8
ENSDART00000133443 Nonsense 44 274 2 10
ENSDART00000135937 Nonsense 44 227 2 9
ENSDART00000136308 Nonsense 20 173 2 8
ENSDART00000138619 Nonsense 20 296 2 12
ENSDART00000139289 Nonsense 20 124 3 7
ENSDART00000139814 Nonsense 20 226 3 11
ENSDART00000141297 Nonsense 54 270 3 12
ENSDART00000144370 Nonsense 20 106 3 7
ENSDART00000144770 Nonsense 20 144 2 7
ENSDART00000148097 Nonsense 44 230 2 9

The following transcripts of ENSDARG00000058693 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 10048473)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGGTCACACCCACCACAACATCTCAGGTCTCCACAGTGAAACCTGCA[C/T]AATATGAGGTAAAGGAGCTCTCATTTCATCTTAATNNNTTGTGTRAYGGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23868
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081614 Nonsense 217 819 9 30
ENSDART00000131448 Nonsense 213 220 8 8
ENSDART00000132699 Nonsense 221 828 9 30
ENSDART00000133171 None None 190 None 8
ENSDART00000133443 Nonsense 217 274 8 10
ENSDART00000135937 None None 227 None 9
ENSDART00000136308 Nonsense 115 173 6 8
ENSDART00000138619 Nonsense 193 296 8 12
ENSDART00000139289 Nonsense 111 124 7 7
ENSDART00000139814 Nonsense 78 226 6 11
ENSDART00000141297 Nonsense 180 270 8 12
ENSDART00000144370 Nonsense 82 106 6 7
ENSDART00000144770 Nonsense 82 144 5 7
ENSDART00000148097 Nonsense 106 230 5 9

The following transcripts of ENSDARG00000058693 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 10036179)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATGTCTCAGCCCAAACTGAAATCAGAGAAAGGTGTTTTGTGTGGTGAG[C/T]GAGATGACACGCTGCCGCCCGGATACAGAAAGGAAGACCTGGTCAGTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15221
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081614 Essential Splice Site 342 819 13 30
ENSDART00000131448 None None 220 None 8
ENSDART00000132699 Essential Splice Site 346 828 13 30
ENSDART00000133171 None None 190 None 8
ENSDART00000133443 None None 274 None 10
ENSDART00000135937 Essential Splice Site 204 227 8 9
ENSDART00000136308 None None 173 None 8
ENSDART00000138619 None None 296 None 12
ENSDART00000139289 None None 124 None 7
ENSDART00000139814 Essential Splice Site 203 226 10 11
ENSDART00000141297 None None 270 None 12
ENSDART00000144370 None None 106 None 7
ENSDART00000144770 None None 144 None 7
ENSDART00000148097 None None 230 None 9

The following transcripts of ENSDARG00000058693 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 10029615)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGCYAAAATGGAGACTCATGCACAACCAGCCAAAGCAAAGACAGAGG[T/G]RAGTCAGAAAATCTAGCTCAAGGCAAAACAYTGCATCRCCATACTTCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14469
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081614 Nonsense 519 819 20 30
ENSDART00000131448 None None 220 None 8
ENSDART00000132699 Nonsense 528 828 20 30
ENSDART00000133171 None None 190 None 8
ENSDART00000133443 None None 274 None 10
ENSDART00000135937 None None 227 None 9
ENSDART00000136308 None None 173 None 8
ENSDART00000138619 None None 296 None 12
ENSDART00000139289 None None 124 None 7
ENSDART00000139814 None None 226 None 11
ENSDART00000141297 None None 270 None 12
ENSDART00000144370 None None 106 None 7
ENSDART00000144770 None None 144 None 7
ENSDART00000148097 None None 230 None 9

The following transcripts of ENSDARG00000058693 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 10001598)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTCAGTGCTTTGGGMGACACTCTTTCTGCCCCAGAACCACCAAAAAAR[C/T]AACCTGACCTGAAACCTAAGGACATCGTACAYGTAATAATGATGTCCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11266
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081614 Nonsense 552 819 21 30
ENSDART00000131448 None None 220 None 8
ENSDART00000132699 Nonsense 561 828 21 30
ENSDART00000133171 None None 190 None 8
ENSDART00000133443 None None 274 None 10
ENSDART00000135937 None None 227 None 9
ENSDART00000136308 None None 173 None 8
ENSDART00000138619 None None 296 None 12
ENSDART00000139289 None None 124 None 7
ENSDART00000139814 None None 226 None 11
ENSDART00000141297 None None 270 None 12
ENSDART00000144370 None None 106 None 7
ENSDART00000144770 None None 144 None 7
ENSDART00000148097 None None 230 None 9

The following transcripts of ENSDARG00000058693 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 10001388)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAAGGAGTTCGTGTTGGAGAAAGAGACGACACACTCCCACCAGAATA[C/A]AGATTCAAAGAGGAAGATCTCAAGAAATATCCTCCTCCTCAGAAAGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3122
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081614 Nonsense 598 819 22 30
ENSDART00000131448 None None 220 None 8
ENSDART00000132699 Nonsense 607 828 22 30
ENSDART00000133171 None None 190 None 8
ENSDART00000133443 None None 274 None 10
ENSDART00000135937 None None 227 None 9
ENSDART00000136308 None None 173 None 8
ENSDART00000138619 None None 296 None 12
ENSDART00000139289 None None 124 None 7
ENSDART00000139814 None None 226 None 11
ENSDART00000141297 None None 270 None 12
ENSDART00000144370 None None 106 None 7
ENSDART00000144770 None None 144 None 7
ENSDART00000148097 None None 230 None 9

The following transcripts of ENSDARG00000058693 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 10000329)
KASP Assay ID:
554-2954.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGGGATTTTACAACTCCYTCCGCACCATCGGCTGTTTCCCCTGCCTCT[A/T]AATCCTCTGCCAAGGCRAGTCCACATCAAATGTCTTWATTGTTTCTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14830
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081614 Nonsense 639 819 24 30
ENSDART00000131448 None None 220 None 8
ENSDART00000132699 Nonsense 648 828 24 30
ENSDART00000133171 None None 190 None 8
ENSDART00000133443 None None 274 None 10
ENSDART00000135937 None None 227 None 9
ENSDART00000136308 None None 173 None 8
ENSDART00000138619 None None 296 None 12
ENSDART00000139289 None None 124 None 7
ENSDART00000139814 None None 226 None 11
ENSDART00000141297 None None 270 None 12
ENSDART00000144370 None None 106 None 7
ENSDART00000144770 None None 144 None 7
ENSDART00000148097 None None 230 None 9

The following transcripts of ENSDARG00000058693 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 9999642)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCACTTTTCTTCGATACYGACTTYCAYTTCTGCTGTTTKTCAAAGTTGT[C/A]WGACGGAACCTCATCAGCTCTRGATGCCCTGTCAGAMACTCTGGGAGACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vsvyu8fc