fzd3l

Ensembl ID:
ENSDARG00000058692
ZFIN ID:
ZDB-GENE-070122-1
Description:
frizzled homolog 3-like [Source:RefSeq peptide;Acc:NP_001074070]
Human Orthologue:
FZD3
Human Description:
frizzled homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:4041]
Mouse Orthologue:
Fzd3
Mouse Description:
frizzled homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:108476]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36326 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36325 Nonsense Mutation detected in F1 DNA During 2016
sa23002 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36326
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121488 Essential Splice Site 75 667 2 7
Genomic Location (Zv9):
Chromosome 17 (position 8407795)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8405137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCTCCTCAACCACTATGACCAGCAGACCGCCGCTCTGGCCATGGAGG[T/A]AAATCTGCTTTTCTTCTGTATTGGCTGTGGATTCAATTCAATTGTATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36325
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121488 Nonsense 323 667 4 7
Genomic Location (Zv9):
Chromosome 17 (position 8360409)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8357751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTTACGATGGCCGGAAGTGTGTGGTGGGTCATTCTCACCATCACTTG[G/A]TTTTTAGCGGCAGTTCCCAAATGGGGCAGTGAAGCCATCGAGAAGAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23002
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121488 Nonsense 461 667 4 7
Genomic Location (Zv9):
Chromosome 17 (position 8359995)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8357337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACCGTGGTGGGGTGTTACCTGTATGAACAGACGTACCGCTCTGTTTG[G/A]GAGACCACGTGGGTGCAGGAGCGCTGCAGAGAGTACCATATACCCTGCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link