si:dkey-204a24.2

Ensembl ID:
ENSDARG00000058690
ZFIN ID:
ZDB-GENE-050208-72
Description:
Cingulin [Source:UniProtKB/Swiss-Prot;Acc:Q1L8T5]
Human Orthologue:
CGN
Human Description:
cingulin [Source:HGNC Symbol;Acc:17429]
Mouse Orthologue:
Cgn
Mouse Description:
cingulin Gene [Source:MGI Symbol;Acc:MGI:1927237]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36778 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36778
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081611 Essential Splice Site 636 1162 9 20
ENSDART00000112404 Essential Splice Site 645 1171 11 22
ENSDART00000132422 Essential Splice Site 636 1161 9 20
Genomic Location (Zv9):
Chromosome 19 (position 8289504)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7748043
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCAGTTGTAAAACAGACCGATGAAACTGATTCAAACTCAGTGATGAAA[G/A]TAAGATACCTGTTGAATTTACACAATCTCAAAGTTTTCTCAATTCTTTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link