ilf3a

Ensembl ID:
ENSDARG00000058660
ZFIN ID:
ZDB-GENE-030131-3151
Description:
hypothetical protein LOC324431 [Source:RefSeq peptide;Acc:NP_001025236]
Human Orthologue:
ILF3
Human Description:
interleukin enhancer binding factor 3, 90kDa [Source:HGNC Symbol;Acc:6038]
Mouse Orthologue:
Ilf3
Mouse Description:
interleukin enhancer binding factor 3 Gene [Source:MGI Symbol;Acc:MGI:1339973]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15639 Nonsense Available for shipment Available now
sa16142 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15639
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081561 Nonsense 587 820 15 19
ENSDART00000128640 Nonsense 587 820 14 19
ENSDART00000131513 Nonsense 191 208 5 5

The following transcripts of ENSDARG00000058660 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 9423639)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAAGAATCCCGTCATGGAGCTCAATGAGAAGCGCAGAAGTCTGAAATA[T/A]GAGCTTGTCTCTGWCAAGGGACGCTTCAACGACAAGACCTTCACTATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16142
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081561 Essential Splice Site 652 820 17 19
ENSDART00000128640 Essential Splice Site 652 820 16 19
ENSDART00000131513 None None 208 None 5

The following transcripts of ENSDARG00000058660 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 9425853)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTTTTCTTGAATAGGTCTACAATATTTGATGTTTTTGTTTTTCTTTA[G/A]GGATATGGTATGGGTGGGGTGTCTTTCAATCGAGGCAGGGGTAGAGGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3fi9753t