si:ch211-200e2.4

Ensembl ID:
ENSDARG00000058647
ZFIN ID:
ZDB-GENE-090313-72
Human Orthologue:
HCK
Human Description:
hemopoietic cell kinase [Source:HGNC Symbol;Acc:4840]
Mouse Orthologue:
Hck
Mouse Description:
hemopoietic cell kinase Gene [Source:MGI Symbol;Acc:MGI:96052]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24256 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24256
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081536 Nonsense 498 499 12 12
ENSDART00000135787 Nonsense 447 448 10 10
Genomic Location (Zv9):
Chromosome 23 (position 7614169)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 7606632
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCGTGCTGGAGGACTTTTACACTGCCACCGAGAGCCAGTATCAGCAA[C/T]AACCTTGAGAAAAACACACACACACATACACACACACACACAAAATATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link