ptprna

Ensembl ID:
ENSDARG00000058646
ZFIN ID:
ZDB-GENE-030131-3511
Description:
protein tyrosine phosphatase, receptor type, Na [Source:RefSeq peptide;Acc:NP_001124060]
Human Orthologue:
PTPRN
Human Description:
protein tyrosine phosphatase, receptor type, N [Source:HGNC Symbol;Acc:9676]
Mouse Orthologue:
Ptprn
Mouse Description:
protein tyrosine phosphatase, receptor type, N Gene [Source:MGI Symbol;Acc:MGI:102765]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34556 Nonsense Mutation detected in F1 DNA During 2017
sa13683 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34556
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081543 Nonsense 127 903 5 23

The following transcripts of ENSDARG00000058646 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 7611181)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7591274
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGGCCGCCGCCGCCTGCAGCTAAGAAAGTTTATTCCAGCCCAAACTCT[G/T]AACCTGGTCCAGCTCAGAGCTATGTGGATTACATGGTTTTAGACCCGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13683
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081543 Essential Splice Site 816 903 None 23

The following transcripts of ENSDARG00000058646 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 7649964)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7630057
KASP Assay ID:
2260-1475.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCAAACRGCATCCCATCGTCCACACGGCCCCTGCTGGACTTCCGCAGG[T/A]ACTGAAAACCACACGGCAGCTTATGCCATRCTGATCAGATGAGCTCCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link