pggt1b

Ensembl ID:
ENSDARG00000058613
ZFIN ID:
ZDB-GENE-050913-85
Description:
geranylgeranyl transferase type-1 subunit beta [Source:RefSeq peptide;Acc:NP_001025426]
Human Orthologue:
PGGT1B
Human Description:
protein geranylgeranyltransferase type I, beta subunit [Source:HGNC Symbol;Acc:8895]
Mouse Orthologue:
Pggt1b
Mouse Description:
protein geranylgeranyltransferase type I, beta subunit Gene [Source:MGI Symbol;Acc:MGI:1917514]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9024 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9024
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081505 Essential Splice Site 271 355 8 9
Genomic Location (Zv9):
Chromosome 8 (position 472104)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 413386
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGCGCAAATAAACTGANNTGTGTGTGTGTGTGTTCTCTGTCTCCACA[G/A]CTGTTGGATGTGTTCCAGYACACAAACTTTGAGAAGAACCGGAACTATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link