si:ch73-263f13.4

Ensembl ID:
ENSDARG00000058608
ZFIN ID:
ZDB-GENE-081104-26
Description:
Novel protein similar to vertebrate WD repeat and SOCS box-containing 2 (WSB2) [Source:UniProtKB/TrE
Human Orthologue:
WSB2
Human Description:
WD repeat and SOCS box-containing 2 [Source:HGNC Symbol;Acc:19222]
Mouse Orthologue:
Wsb2
Mouse Description:
WD repeat and SOCS box-containing 2 Gene [Source:MGI Symbol;Acc:MGI:2144041]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa181 Nonsense Available for shipment Available now
sa10108 Nonsense Available for shipment Available now
sa20354 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa181
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081499 Nonsense 245 395 6 10
ENSDART00000133587 Nonsense 254 406 6 9
Genomic Location (Zv9):
Chromosome 5 (position 13755334)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12052717
KASP Assay ID:
554-0097.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGGACGGGGCGCTGCTCGCYATTGCTTCCTATCATTCAAACACCGGCT[G/A]GTGGCTGGACCTGTGGGACCCCTACACTGCAGACCTGCTGACCAGAGTCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10108
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081499 Nonsense 253 395 6 10
ENSDART00000133587 Nonsense 262 406 6 9
Genomic Location (Zv9):
Chromosome 5 (position 13755309)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12052692
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTCCTATCATTCAAAYACCGGCTRGTGGCTGGACCTGTGGGACCCCTA[C/A]ACTGCAGACCTGCTGACCAGAGTCCAGTATGTCCATCTCTCATSTTWWAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20354
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081499   None 395 None 10
ENSDART00000133587 Nonsense 402 406 9 9
Genomic Location (Zv9):
Chromosome 5 (position 13752239)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12049622
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAATACCTTACTTACAGGGACATTCCCAAGCAAAAGATTCTATATTGT[A/T]AAGAACACGGCAGGTGACTGAAAGCAAGTCATGTATGAGAATCAAATTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link