si:ch211-235e18.3

Ensembl ID:
ENSDARG00000058606
ZFIN ID:
ZDB-GENE-030131-9446
Description:
serine/threonine-protein kinase SIK1 [Source:RefSeq peptide;Acc:NP_001119855]
Human Orthologue:
SIK1
Human Description:
salt-inducible kinase 1 [Source:HGNC Symbol;Acc:11142]
Mouse Orthologue:
Sik1
Mouse Description:
salt inducible kinase 1 Gene [Source:MGI Symbol;Acc:MGI:104754]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34563 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38724 Nonsense Mutation detected in F1 DNA During 2017
sa41359 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34563
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083033 Essential Splice Site 218 811 5 13
ENSDART00000127164 Essential Splice Site 188 437 5 11

The following transcripts of ENSDARG00000058606 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 9172670)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9138168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGGTCTTTGAGGGCAAAGAGTATGAGGGGCCACAGTTAGACATTTGG[G/A]TATGTTCATCATTTTCATTTTTACATGACATGTTATAAAAAATATAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38724
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083033 Nonsense 353 811 8 13
ENSDART00000127164 Nonsense 323 437 8 11

The following transcripts of ENSDARG00000058606 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 9173679)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9139177
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACAGCAGCTACAATCACTTCTCAGCTATCTATTACCTGCTGCTCGAA[A/T]GAGTGAAGGAGCACCGCAGCCAACAGATTAGCCGTCAATGTGGGGCCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41359
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083033 Nonsense 712 811 13 13
ENSDART00000127164   None 437 None 11

The following transcripts of ENSDARG00000058606 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 9175481)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9140979
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCAACTCAAGCAATTCTCCCTCCATGCCAGAAGACCTCCATCGCCTTC[C/T]AGCACAACCTGTGGCAACAACAGCAGTCTTTCGACTCCTCTTCCTCATCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link