jph1a

Ensembl ID:
ENSDARG00000058603
ZFIN ID:
ZDB-GENE-040724-233
Description:
junctophilin 1a [Source:RefSeq peptide;Acc:NP_001159728]
Human Orthologue:
JPH1
Human Description:
junctophilin 1 [Source:HGNC Symbol;Acc:14201]
Mouse Orthologue:
Jph1
Mouse Description:
junctophilin 1 Gene [Source:MGI Symbol;Acc:MGI:1891495]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17440 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17440
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081495 Nonsense 431 683 4 6
ENSDART00000131830 None None 380 None 2
Genomic Location:
Chromosome 24 (position 14540853)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGKTTATGATCTTCCTGACAGGACTGGAATACATCAAGCAGAAGTTCAGT[G/T]AGCCGGTGGAGGAGATTAAAGAAGAAGCACCCAAAGAAGAGGAGAAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oyly1xfe