jph1a

Ensembl ID:
ENSDARG00000058603
ZFIN ID:
ZDB-GENE-040724-233
Description:
junctophilin 1a [Source:RefSeq peptide;Acc:NP_001159728]
Human Orthologue:
JPH1
Human Description:
junctophilin 1 [Source:HGNC Symbol;Acc:14201]
Mouse Orthologue:
Jph1
Mouse Description:
junctophilin 1 Gene [Source:MGI Symbol;Acc:MGI:1891495]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37846 Nonsense Mutation detected in F1 DNA During 2016
sa17440 Nonsense Available for shipment Available now
sa37845 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37846
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081495 Nonsense 309 683 2 6
ENSDART00000131830 Nonsense 309 380 2 2
Genomic Location (Zv9):
Chromosome 24 (position 14610700)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14562148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTTTGGGGTCAGTGAGAGATCCAACGGGCTGAAGTATGAAGGGGAAT[G/A]GATGAACAACAAGAGGCATGGATACGGGTGCACCATATTCCCTGATGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17440
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081495 Nonsense 431 683 4 6
ENSDART00000131830   None 380 None 2
Genomic Location (Zv9):
Chromosome 24 (position 14540853)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14492301
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGKTTATGATCTTCCTGACAGGACTGGAATACATCAAGCAGAAGTTCAGT[G/T]AGCCGGTGGAGGAGATTAAAGAAGAAGCACCCAAAGAAGAGGAGAAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37845
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081495 Nonsense 511 683 4 6
ENSDART00000131830   None 380 None 2
Genomic Location (Zv9):
Chromosome 24 (position 14540613)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14492061
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCGTCACGGCCCGCAAGATCAGCAGAGACAGCACTTCTGTAGCCCGC[A/T]AGATCAGCAAAGAAGAGAGAGCCTCCATTGTGGCCGAAATCACCAAAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link