gdap1

Ensembl ID:
ENSDARG00000058601
ZFIN IDs:
ZDB-GENE-050522-424, ZDB-GENE-050522-424
Description:
ganglioside-induced differentiation-associated protein 1 [Source:RefSeq peptide;Acc:NP_001018511]
Human Orthologue:
GDAP1
Human Description:
ganglioside-induced differentiation-associated protein 1 [Source:HGNC Symbol;Acc:15968]
Mouse Orthologue:
Gdap1
Mouse Description:
ganglioside-induced differentiation-associated-protein 1 Gene [Source:MGI Symbol;Acc:MGI:1338002]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24464 Nonsense Available for shipment Available now
sa44107 Nonsense Mutation detected in F1 DNA During 2017
sa24465 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24464
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081488 Nonsense 24 362 1 6
ENSDART00000134475 Nonsense 34 372 1 6
Genomic Location (Zv9):
Chromosome 24 (position 14618008)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14569456
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAAGGAGAATCTCAGGATGAGAAGGAAATCCTTATTAAAAAAGATGCA[C/T]AAGACAGCGGTGAGATTGTCGAGAGCACAAAAACTAAAGCATCCAAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081488 Nonsense 43 362 1 6
ENSDART00000134475 Nonsense 53 372 1 6
Genomic Location (Zv9):
Chromosome 24 (position 14618067)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14569515
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGAGATTGTCGAGAGCACAAAAACTAAAGCATCCAAACTAATATTGTA[T/G]CACTGGACTCAATCGTTCAGCTCTCAGAAGGTAAGATAAAATTCAACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24465
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081488 Nonsense 349 362 6 6
ENSDART00000134475 Nonsense 359 372 6 6
Genomic Location (Zv9):
Chromosome 24 (position 14629480)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14580928
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTTGTTGGTGCCACACTATTGGTTGGGTTGATCGGGGGCGCCACTTA[T/A]TTGGCTTTCATTTATTTTAAAAAGAGACTTCTTGTGTCTTAAGAGAGCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link