si:ch211-235f6.2

Ensembl ID:
ENSDARG00000058598
ZFIN ID:
ZDB-GENE-090313-99
Human Orthologue:
SOX18
Human Description:
SRY (sex determining region Y)-box 18 [Source:HGNC Symbol;Acc:11194]
Mouse Orthologue:
Sox18
Mouse Description:
SRY-box containing gene 18 Gene [Source:MGI Symbol;Acc:MGI:103559]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12315 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12315
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064496 Nonsense 132 431 2 2
ENSDART00000132992 Nonsense 132 184 2 2
Genomic Location (Zv9):
Chromosome 23 (position 8905868)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 8864009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGCCCAAATACAATGACACTGATTGGATGCTGTTTTTAGGTCAGTCCT[G/A]GAAGGCGCTGAGCACACTCGACAAGCGTCCGTTTGTGGAGGARGCCGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link