nt5c3

Ensembl ID:
ENSDARG00000058597
ZFIN ID:
ZDB-GENE-030131-439
Description:
Cytosolic 5'-nucleotidase 3 [Source:UniProtKB/Swiss-Prot;Acc:Q7SYN4]
Human Orthologue:
NT5C3
Human Description:
5'-nucleotidase, cytosolic III [Source:HGNC Symbol;Acc:17820]
Mouse Orthologue:
Nt5c3
Mouse Description:
5'-nucleotidase, cytosolic III Gene [Source:MGI Symbol;Acc:MGI:1927186]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39078 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42657 Nonsense Mutation detected in F1 DNA During 2017
sa36036 Essential Splice Site Mutation detected in F1 DNA During 2017
sa12040 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39078
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081484 Essential Splice Site 92 320 3 9
Genomic Location (Zv9):
Chromosome 16 (position 8386615)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 7306206
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTTAAGCAGATTTGCCGTCAATGGAAAACGTTGTCCATCATGTCATAG[T/C]GAGTATGCCAAAAAAAGAGTGTATTTGCAACAAAGAATTATGCTCATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42657
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081484 Nonsense 144 320 6 9
Genomic Location (Zv9):
Chromosome 16 (position 8384708)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 7304299
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAATTTTTTTCTTCTTCTTCTTCAGGTATTTTAAGTCTCACACATTAT[T/A]GGTTGAACAGAGATTGGAAAAAGACAAACTTCCAGAGGCCGTCAGAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36036
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081484 Essential Splice Site 220 320 7 9
Genomic Location (Zv9):
Chromosome 16 (position 8383173)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 7302764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCCCAACGTCAAAGTTGTGTCCAACTTCATGGACTTTGATGACAATG[T/C]GAGCCTCAACCCCTTTATAAATGCCATTGGTTCTCGTTATTCTCAAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12040
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081484 Nonsense 241 320 8 9
Genomic Location (Zv9):
Chromosome 16 (position 8383012)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 7302603
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCTTTAAAGGAGAGCTGATCCATGTTTACAACAAGCATGACGGTGCTT[T/A]GAGGAACACGGAGYACTTCAAACAGCTGAAGGACAATGGAAACATTATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link