LOC100006249

Ensembl ID:
ENSDARG00000058585
Human Orthologue:
CHST2
Human Description:
carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2 [Source:HGNC Symbol;Acc:1970]
Mouse Orthologue:
Chst2
Mouse Description:
carbohydrate sulfotransferase 2 Gene [Source:MGI Symbol;Acc:MGI:1891160]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37815 Nonsense Mutation detected in F1 DNA During 2016
sa25206 Nonsense Mutation detected in F1 DNA During 2016
sa30031 Nonsense Mutation detected in F1 DNA During 2016
sa37814 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37815
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081475 Nonsense 47 423 1 1
Genomic Location (Zv9):
Chromosome 24 (position 5869259)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 5756551
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACTAAAGAGCCTCAACAGTGTAACGTCCAGATGAGAAGCACTCCTTA[T/A]CAGGGCAGATCAGACATGCGGTTCCTTTACAGGCCATCGCTTGCTAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25206
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081475 Nonsense 66 423 1 1
Genomic Location (Zv9):
Chromosome 24 (position 5869204)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 5756496
KASP Assay ID:
554-7874.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGATCAGACATGCGGTTCCTTTACAGGCCATCGCTTGCTAAGAAGAGA[C/T]AGCTTGTGTATGTTTTGACCACATGGAGGTCCGGCTCATCGTTTTTCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30031
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081475 Nonsense 243 423 1 1
Genomic Location (Zv9):
Chromosome 24 (position 5868672)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 5755964
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTCACCTCGTGCGAGATCCCAGAGCCGTCGCCAACTCCAGGATCAAAT[C/A]AAGGCACGGGTTGATCCGTGAGAACTTACAGGTGGTCCGAAGCAGGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37814
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081475 Nonsense 256 423 1 1
Genomic Location (Zv9):
Chromosome 24 (position 5868634)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 5755926
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGGATCAAATCAAGGCACGGGTTGATCCGTGAGAACTTACAGGTGGTC[C/T]GAAGCAGGGATCCCAAACTCCGTAGGATACACTTTGTAGATCCCGGCCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link