si:ch211-274f20.2

Ensembl ID:
ENSDARG00000058579
ZFIN ID:
ZDB-GENE-091204-91
Human Orthologues:
CANX, CLGN
Human Descriptions:
calmegin [Source:HGNC Symbol;Acc:2060]
calnexin [Source:HGNC Symbol;Acc:1473]
Mouse Orthologues:
Canx, Clgn
Mouse Descriptions:
calmegin Gene [Source:MGI Symbol;Acc:MGI:107472]
calnexin Gene [Source:MGI Symbol;Acc:MGI:88261]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28263 Nonsense Mutation detected in F1 DNA During 2017
sa7400 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28263
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081458 Nonsense 218 469 6 14
ENSDART00000133904 Nonsense 242 452 7 13
Genomic Location (Zv9):
Chromosome 14 (position 9106265)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 8710747
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTCTTTTGGAAGATATGGACACACCAGTGGCGTCTTCTGACCAAAAA[C/T]AAGAACATTTAACAAATGAAGCCTCTGATCTAAACTTGGAGCAACATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7400
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081458 Missense 291 469 10 14
ENSDART00000133904   None 452 None 13
Genomic Location (Zv9):
Chromosome 14 (position 9108983)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 8713465
KASP Assay ID:
554-4265.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGAAAAACTCAATTAGAGAAAAAGATRTTTTWAAAAAWCTGATAAACC[C/A]TGAAGACAGACCCTGTAATGCTGCAATKTAAGTCAGTTCTATATGCTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link