ccdc106

Ensembl ID:
ENSDARG00000058578
ZFIN ID:
ZDB-GENE-050306-6
Description:
coiled-coil domain containing 106 [Source:RefSeq peptide;Acc:NP_001013323]
Human Orthologue:
CCDC106
Human Description:
coiled-coil domain containing 106 [Source:HGNC Symbol;Acc:30181]
Mouse Orthologue:
Ccdc106
Mouse Description:
coiled-coil domain containing 106 Gene [Source:MGI Symbol;Acc:MGI:2385900]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43237 Nonsense Mutation detected in F1 DNA During 2017
sa43236 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081465 Nonsense 323 357 6 6
ENSDART00000104554 Nonsense 306 340 6 6
ENSDART00000136653   None 232 None 6
Genomic Location (Zv9):
Chromosome 19 (position 10948373)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10406912
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCTGAGGTTGGAGAGTTTGATTCCTCCAAGGAGAAGCTTCTGGATTA[T/A]GCCAGACGCTGCTATAAAGCTCTTGATGAGGAAGCTCACGCAAAGGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43236
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081465 Nonsense 353 357 6 6
ENSDART00000104554 Nonsense 336 340 6 6
ENSDART00000136653   None 232 None 6
Genomic Location (Zv9):
Chromosome 19 (position 10948283)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10406822
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAAGGTGCAGACCTTGAAGAAAACCAACCTCTTGCTGCCCATTTCCTA[C/A]AGGTTCAGGCACTGAATTTCCAAAAATGTGTGTCAGTGGTGTTGAAGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link