abcg2c

Ensembl ID:
ENSDARG00000058574
ZFIN ID:
ZDB-GENE-050517-37
Description:
ATP-binding cassette, sub-family G (WHITE), member 2c [Source:RefSeq peptide;Acc:NP_001034728]
Human Orthologue:
ABCG2
Human Description:
ATP-binding cassette, sub-family G (WHITE), member 2 [Source:HGNC Symbol;Acc:74]
Mouse Orthologues:
Abcg2, Abcg3
Mouse Descriptions:
ATP-binding cassette, sub-family G (WHITE), member 2 Gene [Source:MGI Symbol;Acc:MGI:1347061]
ATP-binding cassette, sub-family G (WHITE), member 3 Gene [Source:MGI Symbol;Acc:MGI:1351624]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7378 Missense Mutation detected in F1 DNA During 2014
sa22207 Nonsense Mutation detected in F1 DNA During 2014
sa7377 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7378
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032322 None 1 634 2 16
ENSDART00000091806 None 1 263 2 7
ENSDART00000141790 Missense 15 185 2 5
Genomic Location:
Chromosome 13 (position 4738954)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGATTTTATTTTTGTTCATTTCAATCTTCCTTCAGGCAGAGGAAGGCA[T/A]CATGCTGGATGAGGTGGTTGTGAATGAGCAGTCGTCCACAGATGCGGAWG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22207
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032322 None None 634 None 16
ENSDART00000091806 Nonsense 228 263 6 7
ENSDART00000141790 None None 185 None 5
Genomic Location:
Chromosome 13 (position 4724825)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACACTGCCAACTCCATCATGGAGCTCCTGCAGAAGTACAAAATCTCATA[T/A]CAAATATACCTGCCTCCCGCTGCAAGCAATAATAAAGTATGCCTTTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7377
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032322 None None 634 None 16
ENSDART00000091806 Missense 233 263 6 7
ENSDART00000141790 None None 185 None 5
Genomic Location:
Chromosome 13 (position 4724812)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCATGGAGCTCCTGCAGAAGTACAAAATCTCATATCAAATATWCCTG[C/T]CTCCCGCTGCAAGCAATAATAAAGTATGCCTTTTAAAAACACTTTCTTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pb9p81a1