pdp2

Ensembl ID:
ENSDARG00000058571
ZFIN ID:
ZDB-GENE-000921-2
Description:
[Source:RefSeq peptide;Acc:NP_571700]
Human Orthologue:
PDP2
Human Description:
pyruvate dehyrogenase phosphatase catalytic subunit 2 [Source:HGNC Symbol;Acc:30263]
Mouse Orthologue:
Pdp2
Mouse Description:
pyruvate dehyrogenase phosphatase catalytic subunit 2 Gene [Source:MGI Symbol;Acc:MGI:1918878]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5907 Nonsense Mutation detected in F1 DNA During 2017
sa10123 Nonsense Available for shipment Available now
sa14867 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5907
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081459 Nonsense 56 534 2 2
ENSDART00000124709 Nonsense 57 535 1 1
Genomic Location (Zv9):
Chromosome 18 (position 6917631)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7495321
KASP Assay ID:
554-3930.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCCCTCCTKTTCTCTTCTCCAGCACGGAGTTTCTCCTCTCGTGGTGGT[C/T]GATCAGATGGWAGCTCAGGGCAGGAAGGAGAGAACAGACWGCATCCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10123
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081459 Nonsense 94 534 2 2
ENSDART00000124709 Nonsense 95 535 1 1
Genomic Location (Zv9):
Chromosome 18 (position 6917517)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7495207
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTTCAGATGAGCCGGCTRCAGATCAAYGCAGTCCTGCGTGCCAATGAA[C/T]AATCTGTTCGYGTKCCAGAGTTCGATGGCCGTGGTGGTCCCAGTCCRGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14867
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081459 Nonsense 350 534 2 2
ENSDART00000124709 Nonsense 351 535 1 1
Genomic Location (Zv9):
Chromosome 18 (position 6916748)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7494438
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGCAAACTGTGRTYGTAGATGAYCGGTTGCTYGGAGTCCTGATGCCRT[T/A]GCGTGCTTTTGGTGATGTGCGGTTTAAGTGGAGTCGTGAGCTACAGCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link