fbxo30

Ensembl ID:
ENSDARG00000058561
ZFIN ID:
ZDB-GENE-040426-1215
Description:
F-box only protein 30 [Source:RefSeq peptide;Acc:NP_957445]
Human Orthologue:
FBXO30
Human Description:
F-box protein 30 [Source:HGNC Symbol;Acc:15600]
Mouse Orthologue:
Fbxo30
Mouse Description:
F-box protein 30 Gene [Source:MGI Symbol;Acc:MGI:1919115]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8723 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8723
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081447 Nonsense 702 740 3 3
ENSDART00000123838 Nonsense 702 740 2 2
Genomic Location:
Chromosome 17 (position 7468259)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTGGAAGTTTGCCAACATTTCCAGCATGGCCGACCACCTCAAGACATG[C/A]AAGTTTAACACAATAGCGCGGCGAGAAGAGGCAATCCCGCTCCCATGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4o70fqd2