LOC560221

Ensembl ID:
ENSDARG00000058558
Human Orthologue:
RP5-1187M17.10
Human Description:
ProSAP-interacting protein 1 [Source:UniProtKB/Swiss-Prot;Acc:O60299]
Mouse Orthologue:
Prosapip1
Mouse Description:
ProSAPiP1 protein Gene [Source:MGI Symbol;Acc:MGI:2656976]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34271 Nonsense Mutation detected in F1 DNA During 2016
sa11195 Nonsense Available for shipment Available now
sa21169 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa34271
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081438 Nonsense 205 728 3 7
Genomic Location (Zv9):
Chromosome 8 (position 1168808)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 1034396
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCGCTCTGCTGGATCGGGTGGAGGCTCGGACGCCCCGCAGTCTCTCTG[T/A]GAGCAGGACAGTCCTGAGCGAGACCCTTCAGGGGGAAACGATGGCCAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11195
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081438 Nonsense 263 728 3 7
Genomic Location (Zv9):
Chromosome 8 (position 1168980)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 1034568
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCCGCTCAGGCCCTCGGGCCCCTCAGTGCCTCCMCCAGYCACATCAAC[A/T]GACTAAGCTCTGCTGCTGCCCCRCTGGAGAAAGGGGAGAAACCCAAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21169
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081438 Nonsense 622 728 6 7
Genomic Location (Zv9):
Chromosome 8 (position 1174957)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 1040545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGCGGCGTCAGCTGGAGCGGCTGCAGGGCGAGCTACACCTGGAGAAA[C/T]AGCAGAGAGAGAGGCAGGCGCTCACCTTTGCGCAGGAGAGACACACCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link