LOC560221

Ensembl ID:
ENSDARG00000058558
Human Orthologue:
RP5-1187M17.10
Human Description:
ProSAP-interacting protein 1 [Source:UniProtKB/Swiss-Prot;Acc:O60299]
Mouse Orthologue:
Prosapip1
Mouse Description:
ProSAPiP1 protein Gene [Source:MGI Symbol;Acc:MGI:2656976]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11195 Nonsense Available for shipment Available now
sa21169 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11195
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081438 Nonsense 263 728 3 7
Genomic Location:
Chromosome 8 (position 1168980)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCCGCTCAGGCCCTCGGGCCCCTCAGTGCCTCCMCCAGYCACATCAAC[A/T]GACTAAGCTCTGCTGCTGCCCCRCTGGAGAAAGGGGAGAAACCCAAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21169
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081438 Nonsense 622 728 6 7
Genomic Location:
Chromosome 8 (position 1174957)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGCGGCGTCAGCTGGAGCGGCTGCAGGGCGAGCTACACCTGGAGAAA[C/T]AGCAGAGAGAGAGGCAGGCGCTCACCTTTGCGCAGGAGAGACACACCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a1d69mww