il11b

Ensembl ID:
ENSDARG00000058557
ZFIN ID:
ZDB-GENE-051019-2
Description:
Interleukin 11b [Source:UniProtKB/TrEMBL;Acc:B8JL90]
Human Orthologue:
IL11
Human Description:
interleukin 11 [Source:HGNC Symbol;Acc:5966]
Mouse Orthologue:
Il11
Mouse Description:
interleukin 11 Gene [Source:MGI Symbol;Acc:MGI:107613]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16559 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16559
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081440 Nonsense 83 192 2 4
ENSDART00000123461 Nonsense 34 141 2 4
Genomic Location:
Chromosome 19 (position 11054064)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCATCCCTGCCCTCACTGAACTACAGCRTAAAAGACCTGCATTCACTT[G/T]AGGTARCACATCCACATCTCTGCCTGYAATCTTCATATCTGCCATGTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ibxxxc7g