ENSDARG00000058556

Ensembl ID:
ENSDARG00000058556
Human Orthologues:
MUC5AC, MUC6
Human Descriptions:
mucin 5AC, oligomeric mucus/gel-forming [Source:HGNC Symbol;Acc:7515]
mucin 6, oligomeric mucus/gel-forming [Source:HGNC Symbol;Acc:7517]
Mouse Orthologues:
Muc5ac, Muc5b, Muc6
Mouse Descriptions:
mucin 5, subtype B, tracheobronchial Gene [Source:MGI Symbol;Acc:MGI:1921430]
mucin 5, subtypes A and C, tracheobronchial/gastric Gene [Source:MGI Symbol;Acc:MGI:104697]
mucin 6, gastric Gene [Source:MGI Symbol;Acc:MGI:2663233]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa927 Nonsense Available for shipment Available now
sa44237 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38012 Nonsense Available for shipment Available now
sa25223 Essential Splice Site Mutation detected in F1 DNA During 2016
sa44238 Essential Splice Site Mutation detected in F1 DNA During 2016
sa7537 Missense Mutation detected in F1 DNA During 2016
sa44239 Nonsense Mutation detected in F1 DNA During 2016
sa24614 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa927
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081428 Nonsense 231 1989 5 45
Genomic Location (Zv9):
Chromosome 25 (position 8624003)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8338908
KASP Assay ID:
554-0832.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTTACGGCAGCCATGACTGTCTGTGCAACACGCTAACAGAGATCTCA[C/T]GACAATGCACACATGCTGGAGGACAACCAGGAACATGGAGGACAGAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081428 Essential Splice Site 561 1989 12 45
Genomic Location (Zv9):
Chromosome 25 (position 8626021)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8340926
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCTTTTCTGCATGTCATTCAGAAATATGCCCAAAGATTTACTATGAAG[T/C]GAGTTCTTTTGTATATTTCCTTTTGAAATGAACTATATACAGTATTTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38012
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081428 Nonsense 636 1989 14 45
Genomic Location (Zv9):
Chromosome 25 (position 8626427)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8341332
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGCTGTGGCCTCACCTGCCGTTCTCTCAGTGGACAAGAAAACACCTGC[C/T]AAGGGTCCTTCACGCCTGTAGATGGCTGTGTTTGTTCTGAGGGAACCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25223
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081428 Essential Splice Site 790 1989 18 45
Genomic Location (Zv9):
Chromosome 25 (position 8627475)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8342380
KASP Assay ID:
554-7465.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGGTGCAAACCATTAAAAGGCTGAATCTATGAATTATGTCTATATTAC[A/G]GCACATGCAGAAATGGGATGTGGGATTGCACGGAAAAAGAGTGTTACGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44238
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081428 Essential Splice Site 836 1989 18 45
Genomic Location (Zv9):
Chromosome 25 (position 8627616)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8342521
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCAAGAAATATTCTTTCCATGGAGACTGTGAACAAATCTTAGTCCAT[G/A]TATGTTTTGCATCAATTTTGGCCTTTCCAAGTTAGAAAGAAAATTAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7537
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081428 Missense 1762 1989 38 45
Genomic Location (Zv9):
Chromosome 25 (position 8648479)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8363384
KASP Assay ID:
554-4050.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTSTTCTGTCTAGTGCCGAAAGACGTTTGTGTGCACAATAACACTGAGT[A/G]TCAGGTGAGTTGYTGAGTTTATASTAACTAGTAACACCAACAGTAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44239
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081428 Nonsense 1827 1989 40 45
Genomic Location (Zv9):
Chromosome 25 (position 8648970)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8363875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACAAGAAGGAGAGTGTTGTGGAACGTGCAAGCAGAAGTCCTGTATTTA[T/A]ACAGCGCCAGATAACACCACTCACACTCTTCAGGTACAAACCTTTCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081428 Essential Splice Site 1879 1989 41 45
Genomic Location (Zv9):
Chromosome 25 (position 8649229)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8364134
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGATCAAACCTAAATGCCCTGACTTTAATCCTGATGACTGTGAGGCT[G/T]TAAGTAGTGGTTGATAAGATATTACCATTAATCAAATTTCCACTTTGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link