popdc1

Ensembl ID:
ENSDARG00000058548
ZFIN IDs:
ZDB-GENE-040624-11, ZDB-GENE-040624-11
Description:
Blood vessel epicardial substance [Source:UniProtKB/Swiss-Prot;Acc:Q5PQZ7]
Human Orthologue:
BVES
Human Description:
blood vessel epicardial substance [Source:HGNC Symbol;Acc:1152]
Mouse Orthologue:
Bves
Mouse Description:
blood vessel epicardial substance Gene [Source:MGI Symbol;Acc:MGI:1346013]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42658 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42658
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081418   None 352 None 8
ENSDART00000081422 Essential Splice Site None 316 8 9
Genomic Location (Zv9):
Chromosome 16 (position 8893071)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 7756325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTCCTGTTCCTCCTCTAGCTGTGACCTCAGATCGGGCCTGATGGGGT[G/A]TAAGATAGTTTTCTTTTTCCTCACTGTCTTTCTATTTCTCAACCCCAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link