lama5

Ensembl ID:
ENSDARG00000058543
ZFIN ID:
ZDB-GENE-030131-9823
Description:
laminin subunit alpha-5 [Source:RefSeq peptide;Acc:NP_001034260]
Human Orthologue:
LAMA5
Human Description:
laminin, alpha 5 [Source:HGNC Symbol;Acc:6485]
Mouse Orthologue:
Lama5
Mouse Description:
laminin, alpha 5 Gene [Source:MGI Symbol;Acc:MGI:105382]

Alleles

There are 15 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5030 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24260 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9662 Nonsense Available for shipment Available now
sa25193 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5029 Nonsense Mutation detected in F1 DNA During 2014
sa18267 Essential Splice Site Available for shipment Available now
sa9446 Nonsense Available for shipment Available now
sa16193 Essential Splice Site Available for shipment Available now
sa16078 Essential Splice Site Available for shipment Available now
sa18231 Essential Splice Site Available for shipment Available now
sa3245 Nonsense Mutation detected in F1 DNA During 2014
sa24259 Nonsense Mutation detected in F1 DNA During 2014
sa6725 Nonsense Mutation detected in F1 DNA During 2014
sa16872 Nonsense Available for shipment Available now
sa13881 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5030
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Essential Splice Site 278 3664 5 80
Genomic Location:
Chromosome 23 (position 9813703)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGTCACCTRATGGGCAAAACCTTGAGAGACCCCACAGTCACACGAAGAG[T/C]AAGACTMCACTTCAGTTTTTAGAATGGACAGAAATTAYAAACAAAGCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24260
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Essential Splice Site 311 3664 6 80
Genomic Location:
Chromosome 23 (position 9813078)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCCACGCTGAGGCCTGTAATGCTCAAGACCCCAATGATCCCTACAAG[T/C]AAGTGACCTTTAAGAATGTTTCATTTATTTATGTGTTTTTAAATGTCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9662
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Nonsense 388 3664 8 80
Genomic Location:
Chromosome 23 (position 9790070)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCTGGACATGCAGGGAGAATACAATGGCGGTGGAGTGTGTGTCGAGTG[C/A]CAGGTGGGCTCAGGTGTACAAACATACAATTATKAAGCAATTGKAGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25193
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Essential Splice Site 664 3664 16 80
Genomic Location:
Chromosome 23 (position 9775068)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAAGACCTTCTTGAGCAACAGGGGATTAAGTTCAAACCTGTCTGTTTC[A/C]GCATGTGATTGCTCAGTGGAGGGCTCTCGCTCCAGCTCCTGTGATCCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Nonsense 1546 3664 36 80
Genomic Location:
Chromosome 23 (position 9738730)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCCCCTCAGGTGCAGGAACAACATTGTTGGCCGTCARTGTGACAGGTG[T/A]TCTCCAGGTTTCTATGGTTACCCCAACTGCAGGCCATGTAACTGCAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18267
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Essential Splice Site 1904 3664 44 80
Genomic Location:
Chromosome 23 (position 9727666)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATGCCTCTGTCATAGAGTAAAAGATGTTNNNTGTTTGGTCTTGTTYAC[A/C]GTTTTGCTATTCGCWGTGTGGAGAAGCCCAATAATATGCGGTGCCTGTGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9446
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Nonsense 2164 3664 49 80
Genomic Location:
Chromosome 23 (position 9721582)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGTGTGATGGTGCTGCTGGAAGATYTGGACAGGATCMGTCATTTTTA[T/A]GAGTCCGTTGCCAATCAGCTGACCAGCCTCAATGCCAGCACCTTCGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16193
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Essential Splice Site 2270 3664 52 80
ENSDART00000045126 Essential Splice Site 2270 3664 52 80
Genomic Location:
Chromosome 23 (position 9720373)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGAAATRYCACAGACAAAGTCAAGTGATGGCATTTGTGCATCTGCTC[A/T]GACATYATACAGCAGGTGAAYCGGACAGCRCAGAATGAGACGCAGGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16078
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Essential Splice Site 2270 3664 52 80
ENSDART00000045126 Essential Splice Site 2270 3664 52 80
Genomic Location:
Chromosome 23 (position 9720373)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGAAATRYCACAGACAAAGTCAAGTGATGGCATTTGTGCATCTGCTC[A/T]GACATYATACAGCAGGTGAAYCGGACAGCRCAGAATGAGACGCAGGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18231
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Essential Splice Site 2563 3664 57 80
Genomic Location:
Chromosome 23 (position 9711304)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCACTGAGCTTTTGAAGTCAGCGGAAGAAYTCAACAACAGCAGTCAGA[G/A]TAAGAAGAGCCAACWCTGGATCTGACTGCCTTATTTTGAATGCTATCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3245
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Nonsense 2655 3664 59 80
Genomic Location:
Chromosome 23 (position 9709111)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGCAGAAGCAGTACGGAGACTCCAACGCCACTAGTGAGGATATCAAC[A/T]AARCCCTCAATGACGCCAACACATCAGGTGCGTGCAGTGAGCCCTTACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24259
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Nonsense 2975 3664 66 80
Genomic Location:
Chromosome 23 (position 9697861)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATACACGTTATCGTTTATTAATGTCATTTTTTTCTCTGTCTCTTAGGAT[A/T]AATACGTGACCATCGCTGTTCTTGATGGCTTTCTGAGGGTCTTTTATAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6725
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Nonsense 3019 3664 67 80
Genomic Location:
Chromosome 23 (position 9697623)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTATGGAMTTATTCATTGTGTTTTTTTTTTTCAGTTGCAAGTCATCCTT[C/T]AACTTAAYAACATGAAAATGCTTGTGAGGCTGGATCGTGAGACGTTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16872
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Nonsense 3100 3664 68 80
Genomic Location:
Chromosome 23 (position 9694958)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTTTGTTCAGATAAAGACCATGAAGAGTTCAGGCATCAGCTTTGGCTG[T/A]CCAGATGACCTGCTGGTGAGAGATTACACTTTNATTCACTTGTGCTGATKC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13881
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Nonsense 3200 3664 71 80
Genomic Location:
Chromosome 23 (position 9690131)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTCTKTGAGTTTCTAWACARTTTTGTCTTTGTTTAGGTTGAGCATTTA[T/A]ATAGAYGATGTGCTCGAGAGTTCTGGAGAAACTGGTAATGTAACCACKAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Colorectal cancer: Meta-analysis of three genome-wide association studies identifies susceptibility loci for colorectal cancer at 1q41, 3q26.2, 12q13.13 and 20q13.33. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jra0hgjf