alcamb

Ensembl ID:
ENSDARG00000058538
ZFIN ID:
ZDB-GENE-030131-1768
Description:
neurolin-like cell adhesion molecule [Source:RefSeq peptide;Acc:NP_997799]
Human Orthologue:
ALCAM
Human Description:
activated leukocyte cell adhesion molecule [Source:HGNC Symbol;Acc:400]
Mouse Orthologue:
Alcam
Mouse Description:
activated leukocyte cell adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:1313266]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12223 Nonsense Available for shipment Available now
sa42525 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35862 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12223
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101204 Nonsense 78 562 3 16
Genomic Location (Zv9):
Chromosome 15 (position 18824774)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19927400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTAAAACACAYGGGTCAGAATGCCTCCTCTCCCACTGATGGTAACTAC[A/T]AGAAYAGAGTCAGWATTAAAAAAGATTTTGGWCTCATCATCACACAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42525
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101204 Essential Splice Site 273 562 7 16
Genomic Location (Zv9):
Chromosome 15 (position 18828754)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19931380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACGGCAGACGGAAACCCCCCACCCTCTCGCTACAACTTCTACATCAAG[G/A]TAAGTCTGAATTACTGTTTGTCTGGAAATTAAAATCTGCTTTTGGATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35862
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101204 Essential Splice Site 483 562 12 16
Genomic Location (Zv9):
Chromosome 15 (position 18831851)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19934477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCTCCAATGATTTGGGTTCTGACACGAGGAGCATCGATGTGTCGTCGC[G/A]TAAGTGTAACTTCTGTCCGCTGCTTCTCTTATTTGACTACTAAACACTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Erectile dysfunction: Pilot genome-wide association search identifies potential loci for risk of erectile dysfunction in type 1 diabetes using the DCCT/EDIC study cohort. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link