pole

Ensembl ID:
ENSDARG00000058533
ZFIN ID:
ZDB-GENE-070705-557
Description:
DNA polymerase epsilon catalytic subunit A [Source:RefSeq peptide;Acc:NP_001121995]
Human Orthologue:
POLE
Human Description:
polymerase (DNA directed), epsilon [Source:HGNC Symbol;Acc:9177]
Mouse Orthologue:
Pole
Mouse Description:
polymerase (DNA directed), epsilon Gene [Source:MGI Symbol;Acc:MGI:1196391]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31416 Nonsense Available for shipment Available now
sa10893 Nonsense Available for shipment Available now
sa6963 Essential Splice Site Confirmed mutation in F2 line During 2017
sa26416 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44601 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31416
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081411 Nonsense 227 2284 7 49
Genomic Location (Zv9):
Chromosome 5 (position 13955277)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12252714
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGAGCAGCTAGACAACATCCTAGACATGCGGGAATATGATGTGCCCTA[T/A]CACGTCCGCGTTTCTATTGACTTAAAGATTCACGTGGTAGGGAGACTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10893
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081411 Nonsense 255 2284 8 49
Genomic Location (Zv9):
Chromosome 5 (position 13955434)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12252871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAGGCTCACTGGTATAATGTGCGGTATAGAGGAAGTGCTTATCCTCCT[G/T]AGATTGTGCGCAGGGACGACCTTGTGGAAAGACCTGTAAGAATCCTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6963
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081411 Essential Splice Site 302 2284 9 49
Genomic Location (Zv9):
Chromosome 5 (position 13956155)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12253592
KASP Assay ID:
554-4706.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGAAACAGACCAGATCATGATGATATCATACATGATAGATGGACAGG[T/C]AACACCATTTGAYGAWAGACTAGTCAGAGTWTATAAAGATTTTATTGGCA
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Hatching:Long-pec
ZFS:0000033
brain
ZFA:0000008
necrotic
PATO:0000647
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
eye
ZFA:0000107
malformed
PATO:0000646
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
head
ZFA:0001114
decreased size
PATO:0000587
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
pericardium
ZFA:0000054
edematous
PATO:0001450
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
trunk
ZFA:0001115
curved dorsal
PATO:0001468
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa26416
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081411 Essential Splice Site 368 2284 11 49
Genomic Location (Zv9):
Chromosome 5 (position 13957725)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12255162
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCAAGCCAAATATTTTTGTCACCTACAACGGGGATTTCTTTGACTGG[T/C]AGGGTAGGATTTTAAATAAACTACATGCATAAAAACTGTGACTTATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44601
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081411 Nonsense 947 2284 24 49
Genomic Location (Zv9):
Chromosome 5 (position 13969645)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAAGTTGATGGCCCGTACTTGGCTATGATCCTGCCTGCCTCCAAAGAA[G/T]AGGGAAAGAAACTAAAGAAAAGGTGAGCAAACCTTCAGATCATTACTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link