cnot10

Ensembl ID:
ENSDARG00000058528
ZFIN ID:
ZDB-GENE-060929-368
Description:
CCR4-NOT transcription complex subunit 10 [Source:UniProtKB/Swiss-Prot;Acc:Q08CL8]
Human Orthologue:
CNOT10
Human Description:
CCR4-NOT transcription complex, subunit 10 [Source:HGNC Symbol;Acc:23817]
Mouse Orthologue:
Cnot10
Mouse Description:
CCR4-NOT transcription complex, subunit 10 Gene [Source:MGI Symbol;Acc:MGI:1926143]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36039 Essential Splice Site Mutation detected in F1 DNA During 2016
sa2836 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa36039
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081407 Essential Splice Site 68 624 4 18
ENSDART00000104172   None 624 None 19
ENSDART00000125111   79 748 3 19
Genomic Location (Zv9):
Chromosome 16 (position 8925189)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 7788443
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAATGAACAAAGCGGTCACTGAGTTTTATAAAAGTGGGCAGACAACAAG[C/T]AGCACCTTGAAGCAGACGCTGATGACCTTGAAGAATCAGGTATGGTATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2836
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081407 Nonsense 100 624 6 18
ENSDART00000104172 Nonsense 100 624 7 19
ENSDART00000125111 Nonsense 224 748 7 19
Genomic Location (Zv9):
Chromosome 16 (position 8930941)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 7794195
KASP Assay ID:
554-2465.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAGCTGTANNNNGTTTGTTGTGTTTGTACTTGCAGTATAAAGTGCGAGCCTA[T/A]ATCCAGATGAAGTCMCTGAAGGCCTGCAAAAGGGAAATCAAATCTGTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link