cnot10

Ensembl ID:
ENSDARG00000058528
ZFIN ID:
ZDB-GENE-060929-368
Description:
CCR4-NOT transcription complex subunit 10 [Source:UniProtKB/Swiss-Prot;Acc:Q08CL8]
Human Orthologue:
CNOT10
Human Description:
CCR4-NOT transcription complex, subunit 10 [Source:HGNC Symbol;Acc:23817]
Mouse Orthologue:
Cnot10
Mouse Description:
CCR4-NOT transcription complex, subunit 10 Gene [Source:MGI Symbol;Acc:MGI:1926143]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2836 Nonsense F2 line generated During 2014
sa7778 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2836
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081407 Nonsense 100 624 6 18
ENSDART00000104172 Nonsense 100 624 7 19
ENSDART00000125111 Nonsense 224 748 7 19
Genomic Location:
Chromosome 16 (position 8930941)
KASP Assay ID:
554-2465.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAGCTGTANNNNGTTTGTTGTGTTTGTACTTGCAGTATAAAGTGCGAGCCTA[T/A]ATCCAGATGAAGTCMCTGAAGGCCTGCAAAAGGGAAATCAAATCTGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7778
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081407 Nonsense 349 624 11 18
ENSDART00000104172 Nonsense 349 624 12 19
ENSDART00000125111 Nonsense 473 748 12 19
Genomic Location:
Chromosome 16 (position 8937579)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATGGAATTTGCAGCAATCTGTTTGCGGAATGCTTTACTCCTGCTGCCA[G/T]AGCATCAACAGCACGACAGYAAACCAGACAACGGCTCCAAGAGCTACAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jmujbqhq