shq1

Ensembl ID:
ENSDARG00000058522
ZFIN ID:
ZDB-GENE-070112-1412
Description:
Protein SHQ1 homolog [Source:UniProtKB/Swiss-Prot;Acc:A1L1R0]
Human Orthologue:
SHQ1
Human Description:
SHQ1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:25543]
Mouse Orthologue:
Shq1
Mouse Description:
SHQ1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1919421]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11709 Essential Splice Site Available for shipment Available now
sa26812 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11709
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035513 Essential Splice Site 48 586 2 12
Genomic Location (Zv9):
Chromosome 6 (position 44090468)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 44161632
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCCAAGAGRAGGAATTTAAGTTCTATGCCAAGCCCTACTTTCTCAGG[T/C]GACTCTGCAAATGCGWTGATTGACATTTTGTTACAGSAAAAAGCATTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26812
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035513 Essential Splice Site 161 586 5 12
Genomic Location (Zv9):
Chromosome 6 (position 44081766)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 44152930
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGTACGGCTTTGGAAATCTTAGGTCTGGAGTCTTCAGTAGACTGCAA[G/A]TAAGAACATTTGTCCTTGGTGATAAGGTCTTTTGAAAAAGTTTTTGATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link