gfra1a

Ensembl ID:
ENSDARG00000058513
ZFIN ID:
ZDB-GENE-010226-2
Description:
Gdnf family receptor alpha 1a [Source:UniProtKB/TrEMBL;Acc:B8JME8]
Human Orthologue:
GFRA1
Human Description:
GDNF family receptor alpha 1 [Source:HGNC Symbol;Acc:4243]
Mouse Orthologue:
Gfra1
Mouse Description:
glial cell line derived neurotrophic factor family receptor alpha 1 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14181 Nonsense Available for shipment Available now
sa22274 Nonsense Mutation detected in F1 DNA During 2014
sa9341 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14181
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081395 None None 97 2 3
ENSDART00000124769 Nonsense 40 471 2 22
Genomic Location:
Chromosome 13 (position 20656756)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTCTAGCTCWAACCGGCTGGACTGTGTGAAGGCGAACGAGCTGTGTT[T/A]GAAGGAGCCGGGATGCAGCTCAAAGTATCGARCTATGAGGCAGTGCGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22274
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081395 Nonsense 24 97 2 3
ENSDART00000124769 Nonsense 75 471 2 22
Genomic Location:
Chromosome 13 (position 20656650)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGAGTCCAACTTCAGTATGGTGACTGGAATGGAGGCAAAGGATGAATG[T/A]CGACTTGTCTTGGACGCTTTAAAGCAGAGTCCTTTGTATAACTGCCGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9341
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081395 None None 97 None 3
ENSDART00000124769 Essential Splice Site 409 471 20 22
Genomic Location:
Chromosome 13 (position 20530350)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTCARCCCKGCTGATAACTCCCTCTACCAGTTCTGTGGTAACATACAG[G/A]TCAGTGGGACTATTGCATATTACACAYATCTTCMACTTTCATGTATGTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5jlq2c2s