ap1s2

Ensembl ID:
ENSDARG00000058504
ZFIN ID:
ZDB-GENE-030131-5448
Description:
AP-1 complex subunit sigma-2 [Source:RefSeq peptide;Acc:NP_991121]
Human Orthologue:
AP1S2
Human Description:
adaptor-related protein complex 1, sigma 2 subunit [Source:HGNC Symbol;Acc:560]
Mouse Orthologue:
Ap1s2
Mouse Description:
adaptor-related protein complex 1, sigma 2 subunit Gene [Source:MGI Symbol;Acc:MGI:1889383]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6197 Nonsense Mutation detected in F1 DNA During 2014
sa2610 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa6197
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054837 None None 157 1 5
ENSDART00000122812 None None 157 None 5
ENSDART00000131115 Nonsense 1 162 1 6
ENSDART00000135761 None None 157 None 5
ENSDART00000144954 None None 168 1 5
Genomic Location:
Chromosome 11 (position 12777987)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCAGCCACAAAGCTCATGCTGCTCACGGGAACGAGTGTAAAAWAAACT[T/A]GAAGGTAAAAGCAACATTTTATCTCTTGCATTGATGGACGATTACAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2610
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054837 None None 157 None 5
ENSDART00000122812 None None 157 None 5
ENSDART00000131115 Essential Splice Site 147 162 5 6
ENSDART00000135761 None None 157 None 5
ENSDART00000144954 None None 168 None 5
Genomic Location:
Chromosome 11 (position 12785094)
KASP Assay ID:
554-3261.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGAAACACARACACTGCTTGTTCTGAATCTTGGATTTATTTAGTGAAG[G/A]TATAAACTAAAATCTGATTCTCATCTTTAACAGGAAGCCGAGACACCACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ut64g9ia