LOC566708

Ensembl ID:
ENSDARG00000058503
Human Orthologue:
FLT3
Human Description:
fms-related tyrosine kinase 3 [Source:HGNC Symbol;Acc:3765]
Mouse Orthologue:
Flt3
Mouse Description:
FMS-like tyrosine kinase 3 Gene [Source:MGI Symbol;Acc:MGI:95559]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15012 Essential Splice Site Available for shipment Available now
sa24498 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15012
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081357 Essential Splice Site 35 956 None 24
ENSDART00000147759 None None 439 None 12

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 24 (position 22321487)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGGACGGTTTAACTGAAGCTCATCCGCGATGCGACACTGATGGATCGG[T/C]AAAGTTTCTTCTTTCTAATCAGCCCYYAGTACAACTGTCTGTCTGGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24498
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081357 Essential Splice Site 597 956 15 24
ENSDART00000147759 Essential Splice Site 184 439 5 12
Genomic Location:
Chromosome 24 (position 22311485)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCAGCAAGCCGGGTGTTTCTGTTCAGGTAGCGGTAAAAATGTTAAAGG[G/A]TAAGTAATGACAAATCTGTTATGAATATTTAAATAAGATAAAATAAATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m7svb98o