LOC566708

Ensembl ID:
ENSDARG00000058503
Human Orthologue:
FLT3
Human Description:
fms-related tyrosine kinase 3 [Source:HGNC Symbol;Acc:3765]
Mouse Orthologue:
Flt3
Mouse Description:
FMS-like tyrosine kinase 3 Gene [Source:MGI Symbol;Acc:MGI:95559]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15012 Essential Splice Site Available for shipment Available now
sa24498 Essential Splice Site Available for shipment Available now
sa37884 Nonsense Mutation detected in F1 DNA During 2016
sa44134 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15012
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081357 Essential Splice Site 35 956 None 24
ENSDART00000147759   None 439 None 12

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 22321487)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21568365
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGGACGGTTTAACTGAAGCTCATCCGCGATGCGACACTGATGGATCGG[T/C]AAAGTTTCTTCTTTCTAATCAGCCCYYAGTACAACTGTCTGTCTGGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24498
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081357 Essential Splice Site 597 956 15 24
ENSDART00000147759 Essential Splice Site 184 439 5 12
Genomic Location (Zv9):
Chromosome 24 (position 22311485)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21558363
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCAGCAAGCCGGGTGTTTCTGTTCAGGTAGCGGTAAAAATGTTAAAGG[G/A]TAAGTAATGACAAATCTGTTATGAATATTTAAATAAGATAAAATAAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37884
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081357 Nonsense 613 956 16 24
ENSDART00000147759 Nonsense 200 439 6 12
Genomic Location (Zv9):
Chromosome 24 (position 22311355)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21558233
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAGAGAAGCACCAGGCAGTGGAGAAGGAAGCTCTGATGTCTGAACTG[A/T]AAATGCTGACTCATATTGGACACCATGAGAACATTGTCAACCTGCTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44134
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081357 Nonsense 870 956 22 24
ENSDART00000147759 Nonsense 396 439 11 12
Genomic Location (Zv9):
Chromosome 24 (position 22303836)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21550714
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGAACAACACTTTCTACAGAATGATTGAAAGTGGATATCACTTGGAG[C/T]AGCCCTATTATGCAGCAGAATCTGTGTAAGTGCCTCTAGTTTTTTTTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link