dnaja3a

Ensembl ID:
ENSDARG00000058494
ZFIN ID:
ZDB-GENE-030131-7837
Description:
dnaJ homolog subfamily A member 3, mitochondrial [Source:RefSeq peptide;Acc:NP_958470]
Human Orthologue:
DNAJA3
Human Description:
DnaJ (Hsp40) homolog, subfamily A, member 3 [Source:HGNC Symbol;Acc:11808]
Mouse Orthologue:
Dnaja3
Mouse Description:
DnaJ (Hsp40) homolog, subfamily A, member 3 Gene [Source:MGI Symbol;Acc:MGI:1933786]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33107 Nonsense Mutation detected in F1 DNA During 2017
sa33108 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081367 Nonsense 300 453 6 11
ENSDART00000128838 Nonsense 300 453 6 12

The following transcripts of ENSDARG00000058494 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 12964898)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 11997123
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTCATCACATCACCCTGTATCGCCTGTCGAGGGACGGGACAAACCAAA[C/T]AAAGGAAAACCGTCACGGTGCCCGTTCCTGCTGGTGGGTTCACTGGGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33108
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081367 Essential Splice Site 447 453 None 11
ENSDART00000128838 Essential Splice Site 447 453 None 12

The following transcripts of ENSDARG00000058494 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 12974232)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12006457
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTTGATCGAGTGGATTTTATAGGTTATTCACTTCTGTTTGTGTTTAC[A/T]GGTAAAAGATCGGCTGGAAACTGAGAGACTTTGCCTTGCTAGTGGAGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link