si:ch73-86n2.3

Ensembl ID:
ENSDARG00000058486
ZFIN ID:
ZDB-GENE-091204-449
Human Orthologue:
CAPS2
Human Description:
calcyphosine 2 [Source:HGNC Symbol;Acc:16471]
Mouse Orthologue:
Caps2
Mouse Description:
calcyphosphine 2 Gene [Source:MGI Symbol;Acc:MGI:2441980]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13844 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13844
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081356 Nonsense 243 470 8 13
ENSDART00000141533   None 86 None 2
Genomic Location (Zv9):
Chromosome 18 (position 6796854)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7374544
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACCCAGGGTGCCGAGCTTCATTTCTGTACAGACGGCCCACACYTCCCC[C/T]AGAGTCTGAGACAGCAGCCGTGCCTGAGCCTCACAGTTACTGATGTGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link