chtf18

Ensembl ID:
ENSDARG00000058480
ZFIN ID:
ZDB-GENE-050522-508
Description:
CTF18, chromosome transmission fidelity factor 18 homolog [Source:RefSeq peptide;Acc:NP_001103572]
Human Orthologue:
CHTF18
Human Description:
CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:18
Mouse Orthologue:
Chtf18
Mouse Description:
CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Ac

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11678 Nonsense Available for shipment Available now
sa18673 Nonsense Available for shipment Available now
sa19429 Nonsense Mutation detected in F1 DNA During 2014
sa5934 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11678
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092058 Nonsense 94 957 3 22
ENSDART00000109177 Nonsense 94 348 3 17
ENSDART00000092058 Nonsense 94 957 3 22
ENSDART00000109177 Nonsense 94 348 3 17

The following transcripts of ENSDARG00000058480 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 8279172)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAGTATRAAGTTTGACTTCTCACAGCYCCTAAACCCAAGAAAAGGAGG[C/T]AAGATGTGGCGAAAAAGCTCCAGTTTGGCGTTGACCAAGATGATGACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18673
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092058 Nonsense 94 957 3 22
ENSDART00000109177 Nonsense 94 348 3 17
ENSDART00000092058 Nonsense 94 957 3 22
ENSDART00000109177 Nonsense 94 348 3 17

The following transcripts of ENSDARG00000058480 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 8279172)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAGTATRAAGTTTGACTTCTCACAGCYCCTAAACCCAAGAAAAGGAGG[C/T]AAGATGTGGCGAAAAAGCTCCAGTTTGGCGTTGACCAAGATGATGACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19429
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092058 Nonsense 337 957 8 22
ENSDART00000109177 Nonsense 337 348 8 17

The following transcripts of ENSDARG00000058480 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 8282665)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGTCCGGTCCCTGTAGAGGCCAGATCAAATTTTACAAACGCTCAAAAT[C/T]AAAACCAGGCCCAACGTTTCAAAACCAAGTCTCAAATGACAGAAGAGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5934
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092058 Nonsense 562 957 14 22
ENSDART00000109177 None None 348 None 17

The following transcripts of ENSDARG00000058480 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 8285959)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCATGCTATCTGTGTGCAGTTTTTACACAGTCGTGGACAGAAGCACT[T/A]GGACCAGCGCAGTGTCAGCTCCATGTGTGTGGGATTGAAAGACCAAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/39hjieop