chtf18

Ensembl ID:
ENSDARG00000058480
ZFIN ID:
ZDB-GENE-050522-508
Description:
CTF18, chromosome transmission fidelity factor 18 homolog [Source:RefSeq peptide;Acc:NP_001103572]
Human Orthologue:
CHTF18
Human Description:
CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:18
Mouse Orthologue:
Chtf18
Mouse Description:
CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Ac

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38244 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11678 Nonsense Available for shipment Available now
sa18673 Nonsense Available for shipment Available now
sa19429 Nonsense Available for shipment Available now
sa5934 Nonsense Mutation detected in F1 DNA During 2016
sa38245 Nonsense Mutation detected in F1 DNA During 2016
sa39550 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38244
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092058 Essential Splice Site 86 957 2 22
ENSDART00000109177 Essential Splice Site 86 348 2 17

The following transcripts of ENSDARG00000058480 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 8277755)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8517560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGAGAGCATCTCTCCGCCGGTATACGAGGAGGAAGAGGAGTCTCTGAG[T/C]GAGTGCTTTACATTGGATTTTTACATTTGTGTCATAAAACACATTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11678
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092058 Nonsense 94 957 3 22
ENSDART00000109177 Nonsense 94 348 3 17
ENSDART00000092058 Nonsense 94 957 3 22
ENSDART00000109177 Nonsense 94 348 3 17

The following transcripts of ENSDARG00000058480 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 8279172)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8518977
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAGTATRAAGTTTGACTTCTCACAGCYCCTAAACCCAAGAAAAGGAGG[C/T]AAGATGTGGCGAAAAAGCTCCAGTTTGGCGTTGACCAAGATGATGACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18673
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092058 Nonsense 94 957 3 22
ENSDART00000109177 Nonsense 94 348 3 17
ENSDART00000092058 Nonsense 94 957 3 22
ENSDART00000109177 Nonsense 94 348 3 17

The following transcripts of ENSDARG00000058480 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 8279172)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8518977
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAGTATRAAGTTTGACTTCTCACAGCYCCTAAACCCAAGAAAAGGAGG[C/T]AAGATGTGGCGAAAAAGCTCCAGTTTGGCGTTGACCAAGATGATGACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19429
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092058 Nonsense 337 957 8 22
ENSDART00000109177 Nonsense 337 348 8 17

The following transcripts of ENSDARG00000058480 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 8282665)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8522470
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGTCCGGTCCCTGTAGAGGCCAGATCAAATTTTACAAACGCTCAAAAT[C/T]AAAACCAGGCCCAACGTTTCAAAACCAAGTCTCAAATGACAGAAGAGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5934
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092058 Nonsense 562 957 14 22
ENSDART00000109177   None 348 None 17

The following transcripts of ENSDARG00000058480 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 8285959)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8525764
KASP Assay ID:
554-3758.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCATGCTATCTGTGTGCAGTTTTTACACAGTCGTGGACAGAAGCACT[T/A]GGACCAGCGCAGTGTCAGCTCCATGTGTGTGGGATTGAAAGACCAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38245
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092058 Nonsense 580 957 14 22
ENSDART00000109177   None 348 None 17

The following transcripts of ENSDARG00000058480 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 8286012)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8525817
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGCGCAGTGTCAGCTCCATGTGTGTGGGATTGAAAGACCAAAACAAG[G/T]GACTGTTCTCAGTTTGGCAGGAGATCTTTCAGCTTCCTCGACTGAAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39550
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092058 Nonsense 802 957 18 22
ENSDART00000109177   None 348 13 17

The following transcripts of ENSDARG00000058480 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 8294241)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8534046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAACCTGACCTACAGACAGGACCGAACGCCAGAGGGACAGTACACTTA[T/A]GTGCTGGAGCCGTGAGTACATGCGCATACATGAGCAACATCATCTTGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link