si:ch211-222n4.5

Ensembl ID:
ENSDARG00000058477
ZFIN ID:
ZDB-GENE-091118-122

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37275 Nonsense Mutation detected in F1 DNA During 2017
sa25153 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2017
sa708 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37275
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065699 Nonsense 132 290 3 6
ENSDART00000146743 Nonsense 132 265 3 5
Genomic Location (Zv9):
Chromosome 21 (position 17786679)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18934931
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACACGGCACATCATGTGGCAGGTAGTGCAGGCTGCCCACATGTGCTG[T/A]CAGCGAGGGGTCCTCCATCGGGACATTAAATTAGAAAACCTCCTGATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25153
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065699 Essential Splice Site 176 290 4 6
ENSDART00000146743 Splice Site None 265 None 5
Genomic Location (Zv9):
Chromosome 21 (position 17786438)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18934690
KASP Assay ID:
554-7609.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCATCAGCTTTCTTACTGTCACTAATGAAGAAAATCTTCTTTTTTTT[T/C]TAGGGACAGAAGATTACTGTCCACCTGAATTTAGATCCAGTGGCAGGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa708
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065699 Nonsense 277 290 6 6
ENSDART00000146743   None 265 None 5
Genomic Location (Zv9):
Chromosome 21 (position 17785657)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18933909
KASP Assay ID:
554-0616.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAAACCAGAGCTGATTCTCAACACTTACCCAGTGCCAGTGCTGTGTGC[C/T]AACACTGTCCTCATCTGTCAACACTTACAGATCCTGACAAAGCTGTAGCT
Associated Phenotype:
Data not yet available

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link