Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-222n4.5
- Ensembl ID:
- ENSDARG00000058477
- ZFIN ID:
- ZDB-GENE-091118-122
Alleles
There are 4 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa37275 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa25153 | Essential Splice Site, Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa44964 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa708 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa37275
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000065699 | Nonsense | 132 | 290 | 3 | 6 |
| ENSDART00000146743 | Nonsense | 132 | 265 | 3 | 5 |
- Genomic Location (Zv9):
- Chromosome 21 (position 17786679)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 18934931 GRCz11 21 18971567 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGACACGGCACATCATGTGGCAGGTAGTGCAGGCTGCCCACATGTGCTG[T/A]CAGCGAGGGGTCCTCCATCGGGACATTAAATTAGAAAACCTCCTGATAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25153
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site, Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000065699 | Essential Splice Site | 176 | 290 | 4 | 6 |
| ENSDART00000146743 | Splice Site | None | 265 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 21 (position 17786438)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 18934690 GRCz11 21 18971326 - KASP Assay ID:
- 554-7609.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAGCATCAGCTTTCTTACTGTCACTAATGAAGAAAATCTTCTTTTTTTT[T/C]TAGGGACAGAAGATTACTGTCCACCTGAATTTAGATCCAGTGGCAGGTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44964
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000065699 | Nonsense | 232 | 290 | 4 | 6 |
| ENSDART00000146743 | Nonsense | 231 | 265 | 4 | 5 |
- Genomic Location (Zv9):
- Chromosome 21 (position 17786270)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 18934522 GRCz11 21 18971158 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAAAACACAGTGACCTGGACTTGACAGACGAAAGAACTTGGATCAAATCT[G/T]GATTGTCAACAGGTGAGCTGGCCATTTATTACAGCAGAGAAAGCCAACTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa708
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000065699 | Nonsense | 277 | 290 | 6 | 6 |
| ENSDART00000146743 | None | 265 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 21 (position 17785657)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 18933909 GRCz11 21 18970545 - KASP Assay ID:
- 554-0616.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGCAAACCAGAGCTGATTCTCAACACTTACCCAGTGCCAGTGCTGTGTGC[C/T]AACACTGTCCTCATCTGTCAACACTTACAGATCCTGACAAAGCTGTAGCT
- Associated Phenotype:
- Data not yet available
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
