ern2

Ensembl ID:
ENSDARG00000058475
ZFIN ID:
ZDB-GENE-090312-15
Human Orthologue:
ERN2
Human Description:
endoplasmic reticulum to nucleus signaling 2 [Source:HGNC Symbol;Acc:16942]
Mouse Orthologue:
Ern2
Mouse Description:
endoplasmic reticulum (ER) to nucleus signalling 2 Gene [Source:MGI Symbol;Acc:MGI:1349436]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17230 Essential Splice Site Available for shipment Available now
sa12750 Nonsense Available for shipment Available now
sa4830 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18038 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17230
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081355 Essential Splice Site 91 950 3 24
ENSDART00000143587 Essential Splice Site 95 927 4 22
Genomic Location:
Chromosome 1 (position 8264186)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACGGMAGTCTGTATGTTCTCGGAGGAAAGAGGAAAGAAGGTCTGATGG[T/G]GAGTRTTGTGAGCGTGGCWGYGGATGTGTTTATCAGAGAGTGACAGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12750
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081355 Nonsense 191 950 6 24
ENSDART00000143587 Nonsense 195 927 7 22
Genomic Location:
Chromosome 1 (position 8262594)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATACAACGATTACTCAGCTCCTCTATATGACGACAAAAAATATGAATA[T/G]AGYAGGYTCCTCACAATGCAYGATTGTAGATATTTACATACAGTTGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4830
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081355 Essential Splice Site 192 950 6 24
ENSDART00000143587 Essential Splice Site 196 927 7 22
Genomic Location:
Chromosome 1 (position 8262591)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAACGATTACTCAGCTCCTCTATATGACGACAAAAAATATGAATATAG[T/C]AGGYTCCTCACAATGCAYGATTGTAGATATTTACATACAGTTGAGGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18038
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081355 Nonsense 691 950 17 24
ENSDART00000143587 Nonsense 668 927 17 22
Genomic Location:
Chromosome 1 (position 8253576)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGATTTAAAGCCCAGGAATATTTTGCTRTCTCTKCCCGGGGMACTGGGT[C/T]GAGTGCGGGCGCTSATCTCAGATTTYGGCTTGTGTAAGAAGCTTCCAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/82qbp0i9