plk1

Ensembl ID:
ENSDARG00000058471
ZFIN ID:
ZDB-GENE-021115-7
Description:
serine/threonine-protein kinase PLK1 [Source:RefSeq peptide;Acc:NP_001003890]
Human Orthologue:
PLK1
Human Description:
polo-like kinase 1 [Source:HGNC Symbol;Acc:9077]
Mouse Orthologue:
Plk1
Mouse Description:
polo-like kinase 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97621]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19428 Nonsense Available for shipment Available now
sa10264 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19428
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081343 Nonsense 295 595 5 11

The following transcripts of ENSDARG00000058471 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 8232354)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8472159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCTTCTGTAGCTGAACTGCTGACTGATGAGTTTTTCACCTCTGGTTA[T/A]GCACCCATGCGGCTGCCCACTTCCTGTCTCACTGTTCCTCCCAGGTTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10264
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081343 Nonsense 458 595 9 11

The following transcripts of ENSDARG00000058471 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 8234424)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8474229
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGCAGTACATCGAYCGCAACTCTYTAGAATCCTACCTCAGTGTTYGCT[C/A]GTATCCCTCTGCACYCTCCAAAAAGGTCTGCATGGTTCTGGNAAKAAWGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link