im:7136778

Ensembl ID:
ENSDARG00000058470
ZFIN ID:
ZDB-GENE-041111-17
Human Orthologue:
MAPK13
Human Description:
mitogen-activated protein kinase 13 [Source:HGNC Symbol;Acc:6875]
Mouse Orthologue:
Mapk13
Mouse Description:
mitogen-activated protein kinase 13 Gene [Source:MGI Symbol;Acc:MGI:1346864]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9763 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9763
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081341 Essential Splice Site 146 362 5 12
Genomic Location:
Chromosome 8 (position 11865759)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGTCTCCACTCCACAGTACATTCATGGCGCTGGCATCATTCACAGAG[T/C]AAGTGAGACTGGCAGTGAATAAACAGCATCTGCTCAKAATTATCATTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/naug0398