prpf40a

Ensembl ID:
ENSDARG00000058467
ZFIN ID:
ZDB-GENE-030131-274
Description:
pre-mRNA-processing factor 40 homolog A [Source:RefSeq peptide;Acc:NP_938170]
Human Orthologue:
PRPF40A
Human Description:
PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:16463]
Mouse Orthologue:
Prpf40a
Mouse Description:
PRP40 pre-mRNA processing factor 40 homolog A (yeast) Gene [Source:MGI Symbol;Acc:MGI:1860512]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31699 Essential Splice Site Available for shipment Available now
sa41344 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13254 Nonsense Available for shipment Available now
sa1197 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31699
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081326 Essential Splice Site 76 851 3 26
Genomic Location (Zv9):
Chromosome 9 (position 4690203)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 4717944
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGATGCCACCTCGTCTGCCAGCTGCATCAATCCAGCCTACAGGACCG[G/T]TAAACTACCCTGAATATCACACTAATCTAGCAGTGCGGGTTAAATATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41344
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081326 Essential Splice Site 146 851 8 26
Genomic Location (Zv9):
Chromosome 9 (position 4698521)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 4726262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATGACACAATTTTCTCATTTGTTTTGAATTCTTGTGCTTATTTTGTA[G/A]CAAATGTTGTCAAAATGCCCATGGAAAGAGTATAAGTCAGACACCGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13254
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081326 Nonsense 376 851 13 26
Genomic Location (Zv9):
Chromosome 9 (position 4703495)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 4731236
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACTTTCCAAMGCTTCCTGGAGAACCACGAGAAGATGACGTCAACCACA[C/T]GATACAAGTGAGTKTWTATACATTATATACAWGTAACWTTATATACARCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1197
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081326 Nonsense 464 851 15 26
Genomic Location (Zv9):
Chromosome 9 (position 4710115)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 4737856
KASP Assay ID:
554-1106.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCAACAGTACCTGCTGGACAATCCAACATTTGCTGAAGACGAGGAGCTA[C/T]AGAGTATGAACGCACAACACACATGCTTGTATAAAGCTCAATTATTTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link